| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.061411 |
| Chromosome: | chromosome 9 |
| Location: | 3634852 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g396994 | (1 of 3) IPR001128//IPR002397//IPR002401//IPR002403 - Cytochrome P450 // Cytochrome P450, B-class // Cytochrome P450, E-class, group I // Cytochrome P450, E-class, group IV | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGCCCCAATTATCGCACTTCCTCAGCTCAAAGCCCTCCGATCAGAATC |
| Internal bar code: | GGAGCCTGGATACGTGTAAGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 90 |
| LEAP-Seq percent confirming: | 2.04082 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 48 |
| LEAP-Seq n unique pos: | 49 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTAGGCGGTAGGACATCG |
| Suggested primer 2: | GAATTGATACGTTGCGGGCC |