Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.061413 |
Chromosome: | chromosome 2 |
Location: | 1862725 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g087324 | (1 of 39) IPR009003 - Peptidase S1, PA clan | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCGCTGAAGGCATCACTGGACGTGTGGCGAGAGACAACTACTAGGGACG |
Internal bar code: | TGGGAACACGTGAACGACAGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1120 |
LEAP-Seq percent confirming: | 4.34783 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 22 |
LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTTGTCAACTCGTGCGCAA |
Suggested primer 2: | GACCGTGTACAGCTATCCGG |