| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.061414 |
| Chromosome: | chromosome 13 |
| Location: | 4511623 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g603000 | PDE19 | (1 of 17) 3.1.4.53 - 3',5'-cyclic-AMP phosphodiesterase / cAMP-specific phosphodiesterase; 3'%252C5'-cyclic-nucleotide phosphodiesterase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAAGTTGCTGGCTGGCTGGAGTTGCATCGCTTGGTGGCCGTGCTCCTCG |
| Internal bar code: | GATTTCGCGAGGCGCACTCCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2065 |
| LEAP-Seq percent confirming: | 96.875 |
| LEAP-Seq n confirming: | 31 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTTTATGCTGCGCCTCGAC |
| Suggested primer 2: | AGACGGTTAGCTGGGTTTGG |