| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.061475 |
| Chromosome: | chromosome 8 |
| Location: | 2053999 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g368950 | SHK2, DHQS,DQS1,DHQS,DHQS1 | (1 of 1) 4.2.3.4 - 3-dehydroquinate synthase / Dehydroquinate synthase; 3-dehydroquinate synthase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATGGGAGTGCGGTAGTCAGGGACTAACTTTTATGTGTGTGTGCGGCCAC |
| Internal bar code: | AGGCGGACACCAGCGCGCGCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3132 |
| LEAP-Seq percent confirming: | 98.3607 |
| LEAP-Seq n confirming: | 60 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 61 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCACCTGCCAACATCCCAG |
| Suggested primer 2: | ATGACCACTGAGCAGTTCCG |