| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.061514 |
| Chromosome: | chromosome 6 |
| Location: | 4899061 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g280550 | (1 of 1) K13107 - RNA-binding motif protein, X-linked 2 (RBMX2, IST3) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTGCGGGAAGCAAGGCGCTGGTCGCGTGCACCCCATCATGCAATGCCG |
| Internal bar code: | GAAATACTTAAAAGATCTCAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1692 |
| LEAP-Seq percent confirming: | 81.4815 |
| LEAP-Seq n confirming: | 66 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 81 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTACCGCCCTGACACAAACT |
| Suggested primer 2: | GACAAAAGGAGTGGAGCCCA |