| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.061540 |
| Chromosome: | chromosome 17 |
| Location: | 2966664 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g802061 | (1 of 11) IPR000626//IPR029071 - Ubiquitin domain // Ubiquitin-related domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGGCAGGAATCCAGTCCGCGCCATGGCGCCTTGTCAGGGCCCACCCAGT |
| Internal bar code: | GTAACGGTGTGGGCAGGAATGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4166 |
| LEAP-Seq percent confirming: | 96.7213 |
| LEAP-Seq n confirming: | 59 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 61 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGGCGTGTGTTGTTGAAGG |
| Suggested primer 2: | TGTCCTTTCCGTGTGCTCTC |