| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.061605 |
| Chromosome: | chromosome 11 |
| Location: | 175167 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467544 | IDI1 | Isopentenyl-diphosphate delta-isomerase; (1 of 1) K01823 - isopentenyl-diphosphate delta-isomerase (idi, IDI) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTTGTTGGTAATCACTCGTCTGATTTGCCAATGGCGCGTATTATGTCGG |
| Internal bar code: | CGAGCGGTCCGCGGGAACCTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 397 |
| LEAP-Seq percent confirming: | 13.1579 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 33 |
| LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTTCGTACCTCGCCTCACC |
| Suggested primer 2: | GGATTGTGTTGGCGCTGTTT |