Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.061661 |
Chromosome: | chromosome 13 |
Location: | 5200340 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g607500 | KU70 | ATP-dependent DNA helicase 2 subunit KU70; (1 of 1) K10884 - ATP-dependent DNA helicase 2 subunit 1 (XRCC6, KU70, G22P1) | 3'UTR |
Cre13.g607550 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTGTACAGGCGGGTGCATTCACAGACTGTGATGCTGATGTAGACTGTA |
Internal bar code: | CTGACGTTACAACGTTTACGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3075 |
LEAP-Seq percent confirming: | 96.2264 |
LEAP-Seq n confirming: | 102 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 106 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTCACACACACAGCAAGCAC |
Suggested primer 2: | CGGCGTGTGTCATATGCAAG |