| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.061699 |
| Chromosome: | chromosome 16 |
| Location: | 6353687 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g675650 | ALDH6,ALD8,ALDH6B1 | (1 of 1) 1.2.1.27 - Methylmalonate-semialdehyde dehydrogenase (CoA acylating) / MSDH; Aldehyde dehydrogenase | 5'UTR_intron |
| Cre16.g675700 | BLZ21 | (1 of 2) IPR000104//IPR004827 - Antifreeze protein, type I // Basic-leucine zipper domain; bZIP transcription factor | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCTATTGCACAATCCAAGAGCAGTACGCCTCCGCACAGAGCCTGGGGTT |
| Internal bar code: | GGAGTCACCGGGTGGACGATTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 710 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCCGTCGTTGAGTCCACAA |
| Suggested primer 2: | TGGTATTCCAGCATCGCGTT |