| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.061742 |
| Chromosome: | chromosome 8 |
| Location: | 3155998 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g376350 | ASF1 | Anti-silencing factor; (1 of 1) K10753 - histone chaperone ASF1 (ASF1) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCATTCTTCGCGGCAAACTTGAAAATCTTTCCGAGCCGAGCAGGGAAAT |
| Internal bar code: | GCGGGATCTACCATTCACAATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1684 |
| LEAP-Seq percent confirming: | 75.0 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTCCTCATCCACGTACTCG |
| Suggested primer 2: | AGGGAAATCGGGCAACTCAG |