Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.061749 |
Chromosome: | chromosome 14 |
Location: | 4112506 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g633750 | IPB2 | (1 of 1) PTHR10527:SF5 - FI07923P; Importin beta-3 homolog | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCTGCTTGCGCTGAATGTGCGGTGGAAGAATGCGCAAGGGGTGGTTTAG |
Internal bar code: | GCTAGCCACCATCGTCTGGTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 655 |
LEAP-Seq percent confirming: | 33.3333 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGTGGGGGTCTACGAATCGA |
Suggested primer 2: | TCTGACCATCTGTTTGCCCC |