| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.061846 |
| Chromosome: | chromosome 12 |
| Location: | 2178559 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g509350 | FAP238 | Flagellar Associated Protein 238; (1 of 140) IPR002048 - EF-hand domain | 5'UTR |
| Cre12.g509400 | RIR2L,RIR3,RIR2B | (1 of 2) K10808 - ribonucleoside-diphosphate reductase subunit M2 (RRM2); Ribonucleoside-diphosphate reductase R2-like subunit | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTATGATTGAATTAGTTGATACCGAGACAACTTAGGTGACGACCGCGGCC |
| Internal bar code: | GTGGTTGCACTGGTTCGTCGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4829 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 85 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 85 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCATCTTGGCCTCGATCTCC |
| Suggested primer 2: | TGCTGCTTCCGTCTTCTCTG |