| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.061866 |
| Chromosome: | chromosome 12 |
| Location: | 6369500 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g537200 | OGD1 | (1 of 1) 1.2.4.2 - Oxoglutarate dehydrogenase (succinyl-transferring) / Oxoglutarate dehydrogenase (lipoamide); 2-oxoglutarate dehydrogenase, E1 subunit | gene_edge/mRNA_edge/3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTGTTTGGTTTAAGGTATGGTATGCGTTCTGGGCAGATTTTGCATTGGG |
| Internal bar code: | CATCGAAATAAATCTGGGTCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1268 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 68 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 68 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCATGTCTGCCAGGAAGCTG |
| Suggested primer 2: | GATAGATACGGAGGGCGCAG |