Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.061868 |
Chromosome: | chromosome 2 |
Location: | 5488840 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g114400 | LIPA2,LAS2 | (1 of 1) PTHR10949//PTHR10949:SF12 - LIPOYL SYNTHASE // LIPOYL SYNTHASE, CHLOROPLASTIC; Lipoic acid synthetase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGTGGCGTGGTGTTTTGGGGTCAAGCACTTGGGGTCAGGCACTTGCATG |
Internal bar code: | ATTTTGACATCTCGAGAGGGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4511 |
LEAP-Seq percent confirming: | 90.6542 |
LEAP-Seq n confirming: | 97 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 107 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCACACTTCACCTCCCTCAC |
Suggested primer 2: | TCGACACCATGCTTGACCTC |