| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.061877 |
| Chromosome: | chromosome 3 |
| Location: | 6766056 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g196600 | RAD17 | (1 of 1) PTHR12172//PTHR12172:SF0 - CELL CYCLE CHECKPOINT PROTEIN RAD17 // RAD17; presequence translocase-associated protein import motor subunit | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTCGCAGTGGTGTGCTTTAACAATTATATTCATGACGGCGGCAGGCAGA |
| Internal bar code: | ACCAGGGTCCCAGAAACGTCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1370 |
| LEAP-Seq percent confirming: | 92.5926 |
| LEAP-Seq n confirming: | 50 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 54 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGGTTTTGCAGGCCCATAT |
| Suggested primer 2: | CAAGACTACCACCCCACACC |