| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.061912 |
| Chromosome: | chromosome 3 |
| Location: | 2110385 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g156600 | GluTRBP,GTRBP1 | (1 of 1) PTHR13343//PTHR13343:SF14 - CREG1 PROTEIN // GENOMIC DNA, CHROMOSOME 3, P1 CLONE: MXL8; Glutamyl-tRNA reductase binding protein 1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGACCCATTCCGTGGACCGCCGCTGCGGCCTCTACATAAAAGAATCGTAG |
| Internal bar code: | GGATGGGTAATGGAGGTTTCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2090 |
| LEAP-Seq percent confirming: | 17.6471 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCGCTGTGGCTTCCTTTTG |
| Suggested primer 2: | TCTACCACCACTTTCCGTGC |