Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.061931 |
Chromosome: | chromosome 16 |
Location: | 7443089 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g681238 | (1 of 1) K03650 - tRNA modification GTPase [EC:3.6.-.-] (mnmE, trmE, MSS1) | 5'UTR | |
Cre16.g681354 | (1 of 41) PF13920 - Zinc finger, C3HC4 type (RING finger) (zf-C3HC4_3) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCTGGACGCTAAACGCCGTGGTGTATGGGCCAGAATTTGCAAAACACGG |
Internal bar code: | CCCAAAGATTTTCCCCCATTAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3317 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 23 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AATAGAGGCCGCTCGTTAGC |
Suggested primer 2: | TCGGTGTGGTGAGGAATTGG |