Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.061949 |
Chromosome: | chromosome 6 |
Location: | 3360382 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g800656 | (1 of 4) PTHR16222//PTHR16222:SF17 - ADP-RIBOSYLGLYCOHYDROLASE // SUBFAMILY NOT NAMED | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACTTGACCTCTGCACACTCCTGTACCATACGTCCATACCACACTGCTT |
Internal bar code: | TTGATATAACCCTAAGCGGAAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 689 |
LEAP-Seq percent confirming: | 95.2381 |
LEAP-Seq n confirming: | 20 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCACCACCACTACAACCTCC |
Suggested primer 2: | AAGTAGCGCAGTTGGAACGA |