| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.062007 |
| Chromosome: | chromosome 2 |
| Location: | 7835403 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g146200 | (1 of 89) PF00076 - RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) (RRM_1) | 3'UTR | |
| Cre02.g146250 | NFS1,NIFS1,CSD1 | (1 of 1) PTHR11601:SF34 - CYSTEINE DESULFURASE, MITOCHONDRIAL; Cysteine desulfurase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGAATCCGCATCCATGCAAGGAAACTTCGGAAAGACACACACATGGGT |
| Internal bar code: | GGGCAATCGCAATCAAAGCTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3870 |
| LEAP-Seq percent confirming: | 98.5507 |
| LEAP-Seq n confirming: | 68 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 69 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACTTGTTGGTCGGTGTTGC |
| Suggested primer 2: | CCAATGCACTGGTGTGTGTG |