Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.062022 |
Chromosome: | chromosome 3 |
Location: | 4976770 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g179350 | MFT16 | Major facilitator superfamily transporter; (1 of 1) PF03825//PF07690 - Nucleoside H+ symporter (Nuc_H_symport) // Major Facilitator Superfamily (MFS_1) | outside_mRNA |
Cre03.g179400 | MFT17 | Major facilitator superfamily transporter; (1 of 22) IPR011701//IPR020846 - Major facilitator superfamily // Major facilitator superfamily domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTAAGCGTCTGTGCACTGTACGCACATTTGGCCAGCGACACGCTCACTG |
Internal bar code: | GCGCAGGACCGGGCAGCGGATA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1542 |
LEAP-Seq percent confirming: | 88.8889 |
LEAP-Seq n confirming: | 8 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCTGACACTGAAGCAGTCT |
Suggested primer 2: | GTAGGGTGTGACGGTGGAAG |