| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.062022 |
| Chromosome: | chromosome 3 |
| Location: | 4976776 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g179350 | MFT16 | Major facilitator superfamily transporter; (1 of 1) PF03825//PF07690 - Nucleoside H+ symporter (Nuc_H_symport) // Major Facilitator Superfamily (MFS_1) | outside_mRNA |
| Cre03.g179400 | MFT17 | Major facilitator superfamily transporter; (1 of 22) IPR011701//IPR020846 - Major facilitator superfamily // Major facilitator superfamily domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTTAAGAAAATAATTTTAGTGCATCGCACCGGCCGATAGCGGATCGGC |
| Internal bar code: | GCTGTCAGGACCGGAGGAAGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1379 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 9 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAGGGTGTGACGGTGGAAG |
| Suggested primer 2: | GCCTGACACTGAAGCAGTCT |