| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.062029 |
| Chromosome: | chromosome 2 |
| Location: | 6543913 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g389089 | CNX5,NOFNIR1,NOFNiR,ARC1 | NO-forming nitrite reductase; (1 of 1) PTHR14237:SF30 - MITOCHONDRIAL AMIDOXIME-REDUCING COMPONENT 1 | 5'UTR |
| Cre09.g389100 | GOT1 | (1 of 3) PF04178 - Got1/Sft2-like family (Got1); Got1, COPII vesicle component | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGTAGCTGTCCCTCTGGGGCCCCAAGTCGTTTAGAAGCACAATTGCAG |
| Internal bar code: | AGACTTTAGGCGCGCGGGACTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 871 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 26 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCGTATGCTTCGAGGATCA |
| Suggested primer 2: | AACTCATTGCCCCCATTCGT |