| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.062035 |
| Chromosome: | chromosome 17 |
| Location: | 1602875 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g707500 | TOC120,TOC159 | Translocon at the outer envelope membrane of chloroplasts, receptor subunit; (1 of 1) PF11886 - Translocase of chloroplast 159/132, membrane anchor domain (TOC159_MAD) | 5'UTR |
| lncRNA_TCONS_00086088 | 5'UTR | ||
| lncRNA_TCONS_00086089 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGGATGCAAGCGCGCGAGTCGTCGGAAGGTCGCCGCCCAGCTCCATGG |
| Internal bar code: | TCGGCCGGATAGTCAAGATCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1297 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTTCTATGCGTGCTAGCGA |
| Suggested primer 2: | CAGTTTCGGCATTGAGGTGC |