| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.062050 |
| Chromosome: | contig 27 |
| Location: | 10767 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre27.g802186 | (1 of 77) IPR029071 - Ubiquitin-related domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTCTTCTGGGCTTGTGTCTTCCGGGGCCGCCAACCGTTCCAGTAAAGA |
| Internal bar code: | TTGGAGCCTCCCGTGCGGGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4795 |
| LEAP-Seq percent confirming: | 0.775194 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 128 |
| LEAP-Seq n unique pos: | 129 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTGCATCGTCATACGGCAC |
| Suggested primer 2: | GTCACATTGACGGGGGATGT |