Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.062058 |
Chromosome: | chromosome 1 |
Location: | 337480 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g001950 | Predicted protein with 3-phosphoshikimate1-carboxyvinyltransferase core domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACGAACAGTCCACGGGCGCGGCGCTGTACACACACTGCGACCATCCCCG |
Internal bar code: | ATGAACGGGATCCGACGGCTGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1590 |
LEAP-Seq percent confirming: | 97.1429 |
LEAP-Seq n confirming: | 34 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AACAAGAACACAGCAACGGC |
Suggested primer 2: | CAGTTGCCTCACAAGTTGCC |