| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.062070 |
| Chromosome: | chromosome 5 |
| Location: | 2415433 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g238600 | PHC36 | (1 of 24) IPR003882//IPR024616 - Pistil-specific extensin-like protein // Pherophorin; Pherophorin-chlamydomonas homolog 36 | 3'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGTATCACCGTGCATGGTTGTATGCGCATCCATGCTTGCCCTCGTCGT |
| Internal bar code: | GATTTAAAAAAAGGTACTTTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1557 |
| LEAP-Seq percent confirming: | 21.875 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACATCCCCATCACACACCA |
| Suggested primer 2: | CGGTGATGCCTACAATTGCG |