| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.062075 |
| Chromosome: | chromosome 17 |
| Location: | 2990560 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g719771 | (1 of 4) PF12576 - Protein of unknown function (DUF3754) (DUF3754) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGAGATGGAGGTGGGGGTAGTTGAACCAGAACATTGACTACCATTGTC |
| Internal bar code: | GGAAATTAAACCGTGCTAATAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 132 |
| LEAP-Seq percent confirming: | 40.0 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGCATCTACAGGGACATCC |
| Suggested primer 2: | GCATCAAAGAGCAGCAAGGG |