Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.062086 |
Chromosome: | chromosome 3 |
Location: | 6792790 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g197000 | POB8 | (1 of 1) K14847 - ribosome production factor 2 (RPF2); Proteome of basal body 8 | 3'UTR |
Cre03.g197050 | HTV2 | (1 of 35) K11253 - histone H3 (H3); Histone H3 variant | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTCTCAAAGTAGTGCCGCACCATCGCGTTCTGGAACAGCTTACAGTGTC |
Internal bar code: | AATCTCGGCAAGATTTCCTATG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 5161 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 65 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 65 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCAGCAAAAGAACGTGTCA |
Suggested primer 2: | AGGTGGCTGGGTTGATAACG |