| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.062111 |
| Chromosome: | chromosome 6 |
| Location: | 7072463 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g297750 | SPL3 | SF3A3 splicing factor 3a, subunit 3; (1 of 1) K12827 - splicing factor 3A subunit 3 (SF3A3, SAP61, PRP9) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCATGGCCTCAACCAGGAGTTCAAGTGCGAGATTTGCGGCAACCAGTC |
| Internal bar code: | CGACGCAAAGGTTGAAAATAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 241 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGAGGTGTCCATACGCGAG |
| Suggested primer 2: | AGGTGAAGGTCCGCAAGATG |