| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.062152 |
| Chromosome: | chromosome 14 |
| Location: | 3401939 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g629960 | (1 of 2) 2.3.2.15 - Glutathione gamma-glutamylcysteinyltransferase / Phytochelatin synthase | intron | |
| lncRNA_TCONS_00220894 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCGAAGCGACTGCACAGTTGCGGTCCCGCGACTGCGTGTCCCTTCTTGG |
| Internal bar code: | GCCCTGTATCACGCCAGGTCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 54 |
| LEAP-Seq percent confirming: | 8.69565 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCGGTGGATTGGATTGGAA |
| Suggested primer 2: | CTGCCAGAATGCGTACATGC |