| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.062171 |
| Chromosome: | chromosome 6 |
| Location: | 362848 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g251400 | MME6 | NADP-dependent malic enzyme 6; (1 of 5) 1.1.1.40 - Malate dehydrogenase (oxaloacetate-decarboxylating) (NADP(+)) / Pyruvic-malic carboxylase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTTTCGCAGTTTCCCCGCTCGCCATTCTATGACAACGCTGCGCGAGCCT |
| Internal bar code: | TATCATCAGGTTTTATACCGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 286 |
| LEAP-Seq percent confirming: | 65.0 |
| LEAP-Seq n confirming: | 13 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCCTGATGTTCAAGAGCCT |
| Suggested primer 2: | TGGTGCTCTATCTCGGTGGA |