| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.062262 |
| Chromosome: | chromosome 2 |
| Location: | 8096146 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g144250 | CYP769A1,CYP13 | (1 of 1) 1.14.13.30 - Leukotriene-B(4) 20-monooxygenase / LTB(4) omega-hydroxylase; Cytochrome P450, CYP4 superfamily | 3'UTR |
| Cre02.g144251 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTCACATGCATGACCAGCTGTCTCACACCTACGCTGCTAAGCACACACA |
| Internal bar code: | CGGTTCTTCGGATATAGGAAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 574 |
| LEAP-Seq percent confirming: | 85.0 |
| LEAP-Seq n confirming: | 34 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTTTAACCCCAACGTGCAG |
| Suggested primer 2: | CCACAATGAGGGCGAAGACT |