Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.062292 |
Chromosome: | chromosome 2 |
Location: | 1499956 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g084050 | SEC62 | SEC62-subunit of ER-translocon; (1 of 1) K12275 - translocation protein SEC62 (SEC62) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGACGCATGGAGACTTTAGATTGCGAATATGTGACAGGGCAATCTCCTC |
Internal bar code: | TTGGCAGGGTGGTTTGGAAGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3088 |
LEAP-Seq percent confirming: | 98.8764 |
LEAP-Seq n confirming: | 88 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 89 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCGCCTTTCACACCTCTGA |
Suggested primer 2: | AGGGAATGTACGAGGGTCGA |