| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.062331 |
| Chromosome: | chromosome 12 |
| Location: | 7424832 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g557252 | (1 of 1) K18985 - engulfment and cell motility protein 2 (ELMO2, CED12A) | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACATGCCACACGGAGCCTACGAGCGGTGTTTTGGCACCCCCTGCGTGTTC |
| Internal bar code: | TTGAAACCAGCAATTATTCAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2290 |
| LEAP-Seq percent confirming: | 97.2222 |
| LEAP-Seq n confirming: | 35 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAATGGCCCGCTATTCTGC |
| Suggested primer 2: | CGAAATCCATGAGCGGCAAG |