Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.062381 |
Chromosome: | chromosome 8 |
Location: | 2623256 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g373250 | POA2 | 20S proteasome alpha subunit B; (1 of 1) K02726 - 20S proteasome subunit alpha 2 (PSMA2) | outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTGCTGCGACGGTGCCCGGTGCCCCAGGCGCGAACGCCCACGAGCGGGA |
Internal bar code: | TAATTGCTCTCTACGTGGAACA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 292 |
LEAP-Seq percent confirming: | 50.0 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCCTTGAAAACCTTTCGCA |
Suggested primer 2: | TGTACACCACACCGATCTGC |