| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.062408 |
| Chromosome: | chromosome 3 |
| Location: | 4117427 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g172600 | (1 of 1) IPR000104//IPR001841//IPR011990//IPR013083 - Antifreeze protein, type I // Zinc finger, RING-type // Tetratricopeptide-like helical domain // Zinc finger, RING/FYVE/PHD-type | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTCCTGCCCGCTGGGCTTCGGCGGGCCGGCTTCAAAGAGCTCGCTGAC |
| Internal bar code: | TGGATCTGAGGTTTGTTCTGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 698 |
| LEAP-Seq percent confirming: | 80.0 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGATGTTGGTGCGGAGGT |
| Suggested primer 2: | AAGTAGTAGTCGGCGGAGGT |