| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.062425 |
| Chromosome: | chromosome 14 |
| Location: | 691421 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g612350 | (1 of 25) IPR001965//IPR011011//IPR013083//IPR019787 - Zinc finger, PHD-type // Zinc finger, FYVE/PHD-type // Zinc finger, RING/FYVE/PHD-type // Zinc finger, PHD-finger | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCTCTCACACCTCCCAAACCCCGCCGAAACGACCCCCAGAAGCACTACC |
| Internal bar code: | AGTGACGGTAGGCGTTTGGCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 6013 |
| LEAP-Seq percent confirming: | 5.0 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 38 |
| LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGACTTGGAGGTCGCAGC |
| Suggested primer 2: | ACTTTGCACCCAGAAACCCA |