Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.062425 |
Chromosome: | chromosome 14 |
Location: | 691440 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g612350 | (1 of 25) IPR001965//IPR011011//IPR013083//IPR019787 - Zinc finger, PHD-type // Zinc finger, FYVE/PHD-type // Zinc finger, RING/FYVE/PHD-type // Zinc finger, PHD-finger | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCACCTGCTTGCGTTCAAACTTGAGAACATGCATTCTGATACTATTAGA |
Internal bar code: | AGTGACGGTAGGCGTTTGGCCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1858 |
LEAP-Seq percent confirming: | 40.7407 |
LEAP-Seq n confirming: | 11 |
LEAP-Seq n nonconfirming: | 16 |
LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACTTTGCACCCAGAAACCCA |
Suggested primer 2: | CAGACTTGGAGGTCGCAGC |