| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.062451 |
| Chromosome: | chromosome 4 |
| Location: | 2562459 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g222550 | (1 of 43) IPR011989 - Armadillo-like helical | 3'UTR | |
| Cre04.g222600 | PHC46 | Putative pherophorin-chlamydomonas homolog; (1 of 71) PF12499 - Pherophorin (DUF3707) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGTTGGATGTCGCGGTGGCAGGATCGCGTGAACGATAAGAGGCCTCAA |
| Internal bar code: | CGCTTTTCACAATATGGACTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 906 |
| LEAP-Seq percent confirming: | 78.7879 |
| LEAP-Seq n confirming: | 26 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCAGGCTGACATTGACACC |
| Suggested primer 2: | AGCTGTGCTTTACGCTGAGT |