| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.062487 |
| Chromosome: | chromosome 16 |
| Location: | 6303346 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g676000 | (1 of 102) PF01753 - MYND finger (zf-MYND) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCTCGCCCCGCAACTGGTACTTCATATGGCGTAGCACACGACGAGGGC |
| Internal bar code: | CGGGAGGGTCTTTGCCCGTCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2240 |
| LEAP-Seq percent confirming: | 81.3953 |
| LEAP-Seq n confirming: | 35 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAATGATGCCCGTAAGCTGC |
| Suggested primer 2: | GCTCCAAGTTGCCTACCCTT |