Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.062526 |
Chromosome: | chromosome 15 |
Location: | 1163228 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre15.g639150 | MDM38 | (1 of 1) K17800 - LETM1 and EF-hand domain-containing protein 1, mitochondrial (LETM1, MDM38); Mitochondrial distribution and morphology protein 38 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAACGCAGCCGAATGTGCTCAGTGCCCAGAGCTGCAGAGTGTGCCAATAC |
Internal bar code: | ATAACTGGATATTATGATAAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 386 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGCGAGGAAGAGATCATCA |
Suggested primer 2: | TACCACACACCGAAACCGAG |