| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.062544 |
| Chromosome: | chromosome 1 |
| Location: | 2941676 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g018400 | ITPK2,IPK | (1 of 2) K00913 - inositol-1,3,4-trisphosphate 5/6-kinase / inositol-tetrakisphosphate 1-kinase (ITPK1); Inositol 1%252C3%252C4-trisphosphate 5/6-kinase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAAGCAGGCGTCAAGTTAGGCAGCAGTAGGTCTTTTGTGACTCTGATTT |
| Internal bar code: | GGTCTAGGGTGGAAGGGAGTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2813 |
| LEAP-Seq percent confirming: | 92.8571 |
| LEAP-Seq n confirming: | 26 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTTCCACTCTCACGCACTT |
| Suggested primer 2: | GTAAGGGTACAGTCTGGGCG |