| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.062586 |
| Chromosome: | chromosome 17 |
| Location: | 5693599 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g740430 | (1 of 1) IPR003663//IPR005828//IPR011701//IPR020846 - Sugar/inositol transporter // Major facilitator, sugar transporter-like // Major facilitator superfamily // Major facilitator superfamily domain | intron | |
| Cre17.g802121 | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCCGCCGCCGCCACAGGTGATGTTGTGCATTGGCATGCTGTCGGCGCC |
| Internal bar code: | AATCACTGAGCGGTGTCGAATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 732 |
| LEAP-Seq percent confirming: | 50.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGCTTTGTGGCTTTTGGTA |
| Suggested primer 2: | TGCTTCCTTACCTCACGCAG |