Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.062593 |
Chromosome: | chromosome 13 |
Location: | 3998998 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g590400 | (1 of 1) PF00041//PF04969 - Fibronectin type III domain (fn3) // CS domain (CS) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCGCTGTGACGGACCGGAACGCTAACGATCCAGGCCTGGCCAGGCTAAA |
Internal bar code: | TGTAATTGTATTAATTCCATGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 366 |
LEAP-Seq percent confirming: | 9.375 |
LEAP-Seq n confirming: | 3 |
LEAP-Seq n nonconfirming: | 29 |
LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCTGCGCAACAAAGAAGAA |
Suggested primer 2: | TCTACGCGTCACACTGCATT |