Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.062642 |
Chromosome: | chromosome 15 |
Location: | 579490 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre15.g636450 | SMM58 | S-adenosyl-L-methionine-dependent methyltransferase; (1 of 1) K15190 - 7SK snRNA methylphosphate capping enzyme [EC:2.1.1.-] (MEPCE, BCDIN3) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCCTGAGGTGGCTGGCGGTTGGCGGTTTGGCGGTGGCTCAGAGGCTGGC |
Internal bar code: | ATGTTGTAGATATATGGCATTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4330 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 61 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 61 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCGATACAGGTCTGGACTC |
Suggested primer 2: | TTTGCACACCTCACACACCT |