Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.062651 |
Chromosome: | chromosome 7 |
Location: | 357690 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g314650 | RECA1,RECA,EZY19 | Chloroplast RecA recombination protein; (1 of 1) PTHR22942:SF1 - MITOCHONDRIAL DNA REPAIR PROTEIN RECA HOMOLOG | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAATCAGCATACACACTTTGCACATCATACATGCCATGTACATTACGGG |
Internal bar code: | GAGGGCTAGGCCATCGAGGCCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2022 |
LEAP-Seq percent confirming: | 94.7368 |
LEAP-Seq n confirming: | 36 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTGGTAGGGCTATGCGGAG |
Suggested primer 2: | AAAGGGTTCATGCACGTTGC |