| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.062686 |
| Chromosome: | chromosome 14 |
| Location: | 3827233 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g632400 | SSA19 | cilia-sensing, structure and/or assembly; (1 of 2) PTHR21131//PTHR21131:SF0 - SERINE-TYPE ENDOPEPTIDASE INHIBITOR // SEMINAL FLUID PROTEIN 33A3 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGACTGGTGGCGACAGCAGCGCGCGCTGCCCCGGATGCAGCCAGCCCA |
| Internal bar code: | TAAACGGGGTTCTCTACTGACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1240 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 37 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCATCACCTCCCTGCCAAAC |
| Suggested primer 2: | CCTTCTATGCGTGCTAGCGA |