| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.062714 |
| Chromosome: | chromosome 2 |
| Location: | 8080955 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g144400 | uS12m,MRPS12 | (1 of 1) K02950 - small subunit ribosomal protein S12 (RP-S12, MRPS12, rpsL); Mitochondrial ribosomal protein S12 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGGCAACGGCGTGCGCGACCTGCCCGGGGTCAAGCTGCGCATCGTGCG |
| Internal bar code: | GACTGTTGAAATAGGCTAGTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 178 |
| LEAP-Seq percent confirming: | 50.0 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGATGCGCACACAAGTATG |
| Suggested primer 2: | CCCGTTCAAGAAGGGCATCT |