Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.062734 |
Chromosome: | mitogenome |
Location: | 8023 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
CreMt.g802342 | nad6,801500,ChrepMp06 | (1 of 1) K03884 - NADH-ubiquinone oxidoreductase chain 6 (ND6); NADH dehydrogenase subunit 6 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAGACTTGGTGTATCCTACGGCAATGCTTAGCAAAGCGCACAACAAAAT |
Internal bar code: | GGATGTGTTTGATGGCACTCAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 118 |
LEAP-Seq percent confirming: | 28.5714 |
LEAP-Seq n confirming: | 4 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTAGCCCCAATGCACATGT |
Suggested primer 2: | CCAGCCGAGCATCCTATGAG |