| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.062735 |
| Chromosome: | chromosome 6 |
| Location: | 8177210 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g306050 | (1 of 37) 2.7.11.17 - Calcium/calmodulin-dependent protein kinase / Microtubule-associated protein 2 kinase | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGCTGAATATCTGCGCTGCATAATATGAGTTCTGATTTCAACTTGATA |
| Internal bar code: | TTGAACCACTATTATGAGTTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3304 |
| LEAP-Seq percent confirming: | 94.0 |
| LEAP-Seq n confirming: | 47 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 50 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTTCCTCCCCTCCCAACAC |
| Suggested primer 2: | TGTCTGTGAGCTCCGACAAC |